Original Article | Livestock Diseases • Pesq. Vet. Bras. 44 • 2024 • https://doi.org/10.1590/1678-5150-PVB-7430 copy
Identificação de Escherichia coli enteropatogênica como causa de mastite em vacas no Brasil
Escherichia coli is recognized as one of the main microorganisms responsible for triggering clinical mastitis, a disease that causes considerable economic losses in the dairy industry. In this context, this study aimed to identify E. coli isolates present in individual milk samples collected from cows diagnosed with clinical mastitis from various regions of Brazil. Additionally, through polymerase chain reaction (PCR), the presence of virulence genes eae, bfpB, escN, aatA, aggR, ipaH, stx1, stx2, est, and eltA was investigated; all associated with the pathotypes of diarrheagenic Escherichia coli (DEC). As an integral part of the study, a comprehensive assessment of the sensitivity profile of the isolates to 11 different antimicrobials widely used in mastitis treatment was also conducted. A total of 198 milk samples were collected from cows diagnosed with clinical mastitis. Among these samples, 12 isolates (6.07%) demonstrated bacterial growth greater than three Colony-Forming Units (CFU) when grown on MacConkey agar medium and morphological characteristics of E. coli. The disc-diffusion test was used to evaluate the susceptibility of these isolates to antimicrobials, and the most predominant resistance was observed concerning streptomycin and tetracycline, affecting 16.67% of the strains analyzed. Notably, all isolates investigated did not demonstrate the presence of the genes eae, aatA, aggR, ipaH, stx1, stx2, est, and eltA. These results indicate that these isolates do not fit the pathotypes known as diarrheagenic Escherichia coli (DEC). However, one of the isolates tested was positive for the bfpB and escN genes. The detection of resistant E. coli associated with clinical mastitis points to possible gaps in the treatment of the disease. Additionally, the presence of resistance genes in E. coli strains indicates the potential to transmit these genes between animals and, perhaps, along the food chain.
INDEX TERMS:
Escherichia coli ; clinical mastitis; antimicrobial resistance; dairy farms; Brazil
Escherichia coli é reconhecida como um dos principais microrganismos responsáveis pelo desencadeamento da mastite clínica, doença que causa perdas econômicas consideráveis na indústria de laticínios. Neste contexto, este estudo teve como objetivo principal a identificação de isolados de E. coli presentes em amostras individuais de leite coletadas de vacas com diagnóstico de mastite clínica, de diversas regiões do Brasil. Adicionalmente, por reação em cadeia da polimerase (PCR), foi investigada a presença dos genes de virulência eae, bfpB, escN, aatA, aggR, ipaH, stx1, stx2, est e eltA, todos associados aos patótipos de E. coli diarreiogênica (DEC). Como parte integrante do estudo, foi realizada uma avaliação abrangente do perfil de sensibilidade dos isolados a 11 antimicrobianos diferentes amplamente utilizados no tratamento da mastite. Foram coletadas 198 amostras de leite de vacas com diagnóstico de mastite clínica. Dentre essas amostras, 12 isolados (6,07%) demonstraram crescimento bacteriano superior a três Unidades Formadoras de Colônia (UFC) quando cultivadas em meio ágar MacConkey e características morfológicas de E. coli. Para avaliar a suscetibilidade desses isolados aos antimicrobianos foi utilizado o teste de disco-difusão, sendo observada a resistência mais predominante em relação à estreptomicina e à tetraciclina, afetando 16,67% das cepas analisadas. É relevante ressaltar que todos os isolados investigados não demonstraram a presença dos genes eae, aatA, aggR, ipaH, stx1, stx2, est e eltA. Estes resultados indicam que estes isolados não se enquadram nos patótipos conhecidos como Escherichia coli diarreiogénica (DEC). Porém, um dos isolados testados apresentou positividade para os genes bfpB e escN. A detecção de E. coli resistente associada à mastite clínica aponta para possíveis lacunas no tratamento da doença. Além disso, a presença de genes de resistência em estirpes de E. coli indica a capacidade potencial de transmitir estes genes entre animais e talvez ao longo da cadeia alimentar.
TERMOS DE INDEXAÇÃO:
Escherichia coli ; mastite clínica; resistência antimicrobiana; fazendas leiteiras; Brasil
Mastitis is characterized by the inflammatory process of the mammary glands of dairy cows and is the disease that negatively impacts dairy farming the most. Clinical cases of the disease involve direct costs, such as milk disposal, treatment of infected animals, and veterinary services (Down et al. 2017Down P.M., Bradley A.J., Breen J.E. & Green M.J. 2017. Factors affecting the cost-effectiveness of on-farm culture prior to the treatment of clinical mastitis in dairy cows. Prev. Vet. Med. 145:91-99. <https://dx.doi.org/10.1016/j.prevetmed.2017.07.006> <PMid:28903881>
https://doi.org/10.1016/j.prevetmed.2017... , 2013Down P.M., Green M.J. & Hudson C.D. 2013. Rate of transmission: A major determinant of the cost of clinical mastitis. J. Dairy Sci. 96(10):6301-6314. <https://dx.doi.org/10.3168/jds.2012-6470> <PMid:23958003>
https://doi.org/10.3168/jds.2012-6470... ).
Regarding its manifestation, mastitis can be classified as either clinical or subclinical. In its clinical condition, inflammatory changes in the mammary glands of the affected animal can be observed. It can affect changes in milk consistency (presence of lumps, pus, and blood) and milk color using the black-bottomed mug test. Systemic and milk changes vary according to the severity of the case, which can be defined as mild, moderate, or severe. The subclinical form is mainly diagnosed by somatic cell count (SCC), as it is not possible to visualize inflammatory changes in the gland nor visible changes in milk (Adkins & Middleton 2018Adkins P.R.F. & Middleton J.R. 2018. Methods for diagnosing mastitis. Vet. Clin. N. Am., Food Anim. Pract. 34(3):479-491. <https://dx.doi.org/10.1016/j.cvfa.2018.07.003> <PMid:30316505>
https://doi.org/10.1016/j.cvfa.2018.07.0... ).
Mastitis could be classified as contagious and environmental. Despite involving etiological agents such as yeasts, algae, and fungi, bacteria are the primary etiological agents responsible for triggering intramammary infections (IMI) (Bag et al. 2021Bag M.A.S., Khan M.S.R., Sami M.D.H., Begum F., Islam M.S., Rahman M.M., Rahman M.T. & Hassan J. 2021. Virulence determinants and antimicrobial resistance of E. coli isolated from bovine clinical mastitis in some selected dairy farms of Bangladesh. Saudi J. Biol. Sci. 28(11):6317-6323. <https://dx.doi.org/10.1016/j.sjbs.2021.06.099> <PMid:34759751>
https://doi.org/10.1016/j.sjbs.2021.06.0... ). Contagious bacterial agents are those transmitted between animals during the milking process and through infected ceilings, milkers’ hands, or milking equipment. In contrast, the agents that cause the so-called environmental mastitis are present throughout the farm environment (milking parlor floor, bedding material of the animals, drinking fountains). Furthermore, they can also be found in the gastrointestinal tract of cattle, such as E. coli (Mahmmod et al. 2018Mahmmod Y.S., Nonnemann B., Svennesen L., Pedersen K. & Klaas I.C. 2018. Typeability of MALDI-TOF assay for identification of non-aureus staphylococci associated with bovine intramammary infections and teat apex colonization. J. Dairy Sci. 101(10):9430-9438. <https://dx.doi.org/10.3168/jds.2018-14579> <PMid:30100507>
https://doi.org/10.3168/jds.2018-14579... , Addis et al. 2020Addis M.F., Maffioli E.M., Ceciliani F., Tedeschi G., Zamarian V., Tangorra F., Albertini M., Piccinini R. & Bronzo V. 2020. Influence of subclinical mastitis and intramammary infection by coagulase-negative staphylococci on the cow milk peptidome. J. Proteomics 226:103885. <https://dx.doi.org/10.1016/j.jprot.2020.103885> <PMid:32645476>
https://doi.org/10.1016/j.jprot.2020.103... ).
E. coli, being ubiquitous in the environment, takes on significance as a relevant bacterial agent in cases of clinical cattle mastitis. This species has a wide variety of diarrheagenic E. coli pathotypes (DEC), such as Enteropathogenic (EPEC), Enteroinvasive (EIEC), Enterotoxigenic (ETEC), Enteroaggregative (EAEC), Enterohemorrhagic (EHEC) and Diffusely Adherent (DAEC) (Orsi et al. 2023Orsi H., Guimarães F.F., Leite D.S., Guerra S.T., Joaquim S.F., Pantoja J.C.F., Hernandes R.T., Lucheis S.B., Ribeiro M.G., Langoni H. & Rall V.L.M. 2023. Characterization of mammary pathogenic Escherichia coli reveals the diversity of Escherichia coli isolates associated with bovine clinical mastitis in Brazil. J. Dairy Sci. 106(2):1403-1413. <https://dx.doi.org/10.3168/jds.2022-22126> <PMid:36567244>
https://doi.org/10.3168/jds.2022-22126... ).
E. coli isolates have a wide diversity of genes that encode virulence factors and encompass adhesins, siderophores, toxins, lipopolysaccharides, and protactins, which help circumvent the host’s immune system (Steimle et al. 2016Steimle A., Autenrieth I.B. & Frick J.-S. 2016. Structure and function: Lipid A modifications in commensals and pathogens. Int. J. Med. Microbiol. 306(5):290-301. <https://dx.doi.org/10.1016/j.ijmm.2016.03.001> <PMid:27009633>
https://doi.org/10.1016/j.ijmm.2016.03.0... , Chen et al. 2017Chen W., Liu Y., Yin J., Deng Y., Ali T., Zhang J., Cheng J., Rahman S.U., Gao J. & Han B. 2017. Cloning, expression, and immunogenicity of fimbrial-f17a subunit vaccine against Escherichia coli isolated from bovine mastitis. Biomed Res. Int. 2017:3248483. <https://dx.doi.org/10.1155/2017/3248483> <PMid:29333439>
https://doi.org/10.1155/2017/3248483... , Orsi et al. 2023Orsi H., Guimarães F.F., Leite D.S., Guerra S.T., Joaquim S.F., Pantoja J.C.F., Hernandes R.T., Lucheis S.B., Ribeiro M.G., Langoni H. & Rall V.L.M. 2023. Characterization of mammary pathogenic Escherichia coli reveals the diversity of Escherichia coli isolates associated with bovine clinical mastitis in Brazil. J. Dairy Sci. 106(2):1403-1413. <https://dx.doi.org/10.3168/jds.2022-22126> <PMid:36567244>
https://doi.org/10.3168/jds.2022-22126... ). However, it cannot be stated that the nonspecific profile of virulence factors is directly associated with cases of mastitis (Leimbach et al. 2017Leimbach A., Poehlein A., Vollmers J., Görlich D., Daniel R. & Dobrindt U. 2017. No evidence for a bovine mastitis Escherichia coli pathotype. BMC Genomics 18:359. <https://dx.doi.org/10.1186/s12864-017-3739-x> <PMid:28482799>
https://doi.org/10.1186/s12864-017-3739-... ).
Antimicrobials have been widely used in veterinary medicine to control mastitis for decades. However, the excessive use of these drugs encouraged the emergence of resistance in mastitis-causing E. coli isolates, reducing the effectiveness of the various groups of antibiotics (Zhang et al. 2018Zhang D., Zhang Z., Huang C., Gao X., Wang Z., Liu Y., Tian C., Hong W., Niu S. & Liu M. 2018. The phylogenetic group, antimicrobial susceptibility, and virulence genes of Escherichia coli from clinical bovine mastitis. J. Dairy Sci. 101(1):572-580. <https://dx.doi.org/10.3168/jds.2017-13159> <PMid:29055550>
https://doi.org/10.3168/jds.2017-13159... ). This condition occurs due to a complex communication of different means that grant resistance to several classes of antimicrobials. A commonly identified resistance medium in E. coli is the expression of extended-spectrum beta-lactamases (ESBLs), which collaborates with the transmission of resistance between E. coli isolates (Bandyopadhyay et al. 2015Bandyopadhyay S., Samanta I., Bhattacharyya D., Nanda P.K., Kar D., Chowdhury J., Dandapat P., Das A.K., Batul N., Mondal B., Dutta T.K., Das G., Das B.C., Naskar S., Bandyopadhyay U.K., Das S.C. & Bandyopadhyay S. 2015. Co-infection of methicillin-resistant Staphylococcus epidermidis, methicillin-resistant Staphylococcus aureus, and extended spectrum β-lactamase producing Escherichia coli in bovine mastitis - three cases reported from India. Vet. Q. 35(1):56-61. <https://dx.doi.org/10.1080/01652176.2014.984365> <PMid:25444074>
https://doi.org/10.1080/01652176.2014.98... , Nagy et al. 2015Nagy B., Szmolka A., Smole Možina S., Kovač J., Strauss A., Schlager S., Beutlich J., Appel B., Lušicky M., Aprikian P., Pászti J., Tóth I., Kugler R. & Wagner M. 2015. Virulence and antimicrobial resistance determinants of verotoxigenic Escherichia coli (VTEC) and of multidrug-resistant E. coli from foods of animal origin illegally imported to the EU by flight passengers. Int. J. Food Microbiol. 209:52-59. <https://dx.doi.org/10.1016/j.ijfoodmicro.2015.06.026> <PMid:26148965>
https://doi.org/10.1016/j.ijfoodmicro.20... , Orsi et al. 2023Orsi H., Guimarães F.F., Leite D.S., Guerra S.T., Joaquim S.F., Pantoja J.C.F., Hernandes R.T., Lucheis S.B., Ribeiro M.G., Langoni H. & Rall V.L.M. 2023. Characterization of mammary pathogenic Escherichia coli reveals the diversity of Escherichia coli isolates associated with bovine clinical mastitis in Brazil. J. Dairy Sci. 106(2):1403-1413. <https://dx.doi.org/10.3168/jds.2022-22126> <PMid:36567244>
https://doi.org/10.3168/jds.2022-22126... ).
The aim of this study is to estimate the frequency of ESBL-producing E. coli in milk samples from cows with clinical mastitis from dairy farms in different geographic regions of Brazil. Additionally, it aims to estimate the prevalence of resistance to commonly used antimicrobials in mastitis treatment and perform molecular identification of virulence genes associated with enteropathogenic E. coli (DEC) pathotypes.
Animal Ethics. This study was approved by the Genetic Heritage Management Council of the National System of Management of Genetic Heritage and Associated Knowledge (registration number: A4784B5) and by the Ethics Chamber in the Use of Animals (CEUA) of the “Universidade Federal de Goiás” (MB number 057/21).
Study design and origin of Escherichia coli isolates. In total, 198 milk samples were collected from cows with clinical mastitis on 12 farms. Of these, 11 farms use mechanical milking, while one farm employs manual milking. These farms employ different management strategies and are located in the states of Goiás, Pará, Paraíba, São Paulo, and Santa Catarina, Brazil. The collection process was carried out between the first half of 2021 (March) and the first half of 2022 (February). All samples were collected aseptically in sterile tubes after performing pre-milking hygiene procedures, and the ceiling tips were disinfected with cotton containing 70% alcohol. The transport of samples containing 15mL of milk each was carried out under refrigeration (4°C to 8°C) until microbiological culture.
The methodology and interpretation criteria used to diagnose mastitis in individual samples were based on detecting clinical mastitis cases by local and/or systemic changes in the animal.
Isolation and identification. The isolation and identification of E. coli were performed by sowing 10μL of each sample onto plates of MacConkey agar. The plates were incubated under aerobic conditions at 37°C for 72 h. The E. coli as a causative of intramammary infection was defined by at least three CFU of E. coli. Identifying the pathogen in the samples was carried out according to the morpho-dyeing characteristics and biochemical and culture tests as described by Quinn et al. (2005)Quinn P.J., Markey B.K, Carter M.E., Donnelly W.J. & Leonard F.C. 2005. Microbiologia Veterinária e Doenças Infecciosas. Artmed, São Paulo. 512p..
The characteristic colonies were submitted to biochemical tests recommended for differentiation of enterobacteria, such as Simmons citrate, indole production, Voges-Proskauer test (VP), and methyl red (VM), following the methodology described by Koneman (1997)Koneman E.W.A.S. 1997. The Gram Positive Cocci: Staphylococci and related organism, p.253-320. In: Koneman E.W., Allen S.D., Janda W.M., Schreckenberger P.C. & Winn W.C. (Eds), Color Atlas and Textbook of Diagnostic Microbiology. 5th ed. Lippincott Williams and Wilkins, Philadelphia. and Macfaddin (2000)MacFaddin J.F. 2000. Biochemical Tests for Identification of Medical Bacteria. 3rd ed. Lippincott Williams & Wilkins, Philadelphia. 912p..
The strains that were positive in the indole and methyl red (MV) production tests and negative in the Simmons citrate and Voges-Proskauer (VP) tests were classified as E. coli (Silva et al. 2001Silva N., Junqueira V.C.A. & Silveira N.F.A. 2001. Manual de Métodos de Análise Microbiológica de Alimentos. 2ª ed. Varela, São Paulo. 295p., Trabulsi et al. 2004Trabulsi L.R., Alterthum F., Martinez M.B., Campos L.C., Gompertz O.F., Rácz M.L., Ventura A.M., Corrêa B., Mendes C.M.F., Taddei C.R., Menck C.F.M., Menezes C.A., Vaz C.A.C., Paula C.R., Moreira C.G., Santos D.S., Mehnert D.U., Padilla G., Fernandez H., Resque H.R., Mímica I.M., Gutierrez Rivera I.N., Kotait I., Candeias J.A.N., Ordoñez J.G., Castilho J.G., Avelar K.E.S., Santos K.R.N., Sircili M.P., Teixeira L.M., Mímica L.M.J., Basso L.A., Sampaio M.C., Franzolin M.R., Ferreira M.C.S., Carvalhal M.L., Carrieri M.L., Domingos M.O., Pereira M.M., Barreto M.L., Uzeda M., Lincopan N., Sant’Anna O.A., Duarte R.S., Domingues R.M.C.P., Ducati R.G., Piazza R.M.F., Costa S.O.P., Gomes T.A.T., Bueris V., Mundford V., Elias Junior W.P. & Gambale W. 2004. Microbiologia. Atheneu, São Paulo. 718p., Clermont et al. 2019Clermont O., Dixit O.V.A., Vangchhia B., Condamine B., Dion S., Bridier-Nahmias A., Denamur E. & Gordon D. 2019. Characterization and rapid identification of phylogroup G in Escherichia coli, a lineage with high virulence and antibiotic resistance potential. Environ. Microbiol. 21(8):3107-3117. <https://dx.doi.org/10.1111/1462-2920.14713> <PMid:31188527>
https://doi.org/10.1111/1462-2920.14713... ). For confirmation, the isolates were also identified by mass spectrometry (MALDI-TOF).
Antimicrobial susceptibility test. The disc-diffusion technique was used to evaluate the antimicrobial resistance profile of E. coli isolates (Bauer et al. 1966Bauer A.W., Kirby W.M.M., Sherris J.C. & Turck M. 1966. Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 45(4):493-496. <https://dx.doi.org/10.1093/ajcp/45.4_ts.493>
https://doi.org/10.1093/ajcp/45.4_ts.493... ), according to criteria recommended by the Clinical and Laboratory Standards Institute (CLSI 2022CLSI 2022. M100 Performance Standards for Antimicrobial Susceptibility Testing. 32nd ed. Clinical and Laboratory Standards Institute.). The isolates were cultured on BHI agar at 35°C/6 h, diluted in saline solution (0.9% NaCl) to the 0.5 McFarland scale (1.5 x 108 CFU) and sown in Mueller Hinton agar (MH, Oxoid) with the aid of a sterile swab. The antibiotics, ampicillin (AMP, 10μg), cefepime (CPM, 30μg), cefotaxime (CTX, 30μg), ceftriaxone (CRO, 30μg), cefoxitin (CFO, 30μg), ceftazidime (CAZ, 30μg), ceftiofur (CTF, 30μg), aztreonam (ATM, 30μg), gentamicin (GEN, 10μg), streptomycin (EST, 10μg) and tetracycline (TET, 30μg) were added to the MH plates and incubated at 35±2°C/18 h, to determine the diameters of the inhibition halos. The strain of Escherichia coli ATCC 25922 was used as quality control for the tests.
Disc-diffusion test for investigation of extended-spectrum β-lactamase (ESBL)-producing E. coli. For the investigation of ESBL-producing E. coli, the isolates were submitted to a screening test by disk diffusion (Bauer et al. 1966Bauer A.W., Kirby W.M.M., Sherris J.C. & Turck M. 1966. Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 45(4):493-496. <https://dx.doi.org/10.1093/ajcp/45.4_ts.493>
https://doi.org/10.1093/ajcp/45.4_ts.493... ) using the antibiotics CRO, CTX, CAZ, and ATM. Isolates with a halo less than or equal to that recommended by CLSI (2022)CLSI 2022. M100 Performance Standards for Antimicrobial Susceptibility Testing. 32nd ed. Clinical and Laboratory Standards Institute. (CRO ≤ 25mm or CTX ≤ 27mm or CAZ ≤ 22mm or TMJ ≤ 27mm) were selected for the confirmatory test consisting of the same test with the addition of the amoxicillin-clavulanic acid disc (CAM, 30μg) at a distance of 20mm from the antibiotic discs, as an inhibitor of β-lactamases. The presence of distorted halos or phantom zones characterizes ESBL-producing E. coli.
DNA extraction and molecular detection of virulence markers associated with the main pathotypes of diarrheagenic Escherichia coli (DEC). Each E. coli isolate was seeded on a brain heart infusion broth (BHI) agar plate, transferred to a microcentrifuge tube with 200μL of sterile Milli-Q water, and boiled for 10 min. After cooling in ice, each isolate was centrifuged at 10,000 x g for 1 min, and the supernatant was transferred to a new microtube and frozen for future polymerase chain reactions (PCRs) (Dias et al. 2016Dias R.C.B., Dos Santos B.C., Dos Santos L.F., Vieira M.A., Yamatogi R.S., Mondelli A.L., Sadatsune T., Sforcin J.M., Gomes T.A.T. & Hernandes R.T. 2016. Diarrheagenic Escherichia coli pathotypes investigation revealed atypical enteropathogenic E. coli as putative emerging diarrheal agents in children living in Botucatu, São Paulo State, Brazil. Apmis 124(4):299-308. <https://dx.doi.org/10.1111/apm.12501> <PMid:26752102>
https://doi.org/10.1111/apm.12501... ).
To identify isolates of diarrheagenic E. coli (DEC), the main genes associated with virulence for these pathotypes were investigated, namely: eae (Reid et al. 1999Reid S.D., Betting D.J. & Whittam T.S. 1999. Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR. J. Clin. Microbiol. 37(8):2719-2722. <https://dx.doi.org/10.1128/jcm.37.8.2719-2722.1999> <PMid:10405431>
https://doi.org/10.1128/jcm.37.8.2719-27... ), bfpB (Müller et al. 2007Müller D., Greune L., Heusipp G., Karch H., Fruth A., Tschäpe H. & Schmidt M.A. 2007. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 73(10):3380-3390. <http://dx.doi.org/10.1128/aem.02855-06> <PMid:17400780>
https://doi.org/http://dx.doi.org/10.112... ), escN (Dias et al. 2016Dias R.C.B., Dos Santos B.C., Dos Santos L.F., Vieira M.A., Yamatogi R.S., Mondelli A.L., Sadatsune T., Sforcin J.M., Gomes T.A.T. & Hernandes R.T. 2016. Diarrheagenic Escherichia coli pathotypes investigation revealed atypical enteropathogenic E. coli as putative emerging diarrheal agents in children living in Botucatu, São Paulo State, Brazil. Apmis 124(4):299-308. <https://dx.doi.org/10.1111/apm.12501> <PMid:26752102>
https://doi.org/10.1111/apm.12501... ), aatA (Schmidt et al. 1995Schmidt H., Knop C., Franke S., Aleksic S., Heesemann J. & Karch H. 1995. Development of PCR for screening of enteroaggregative Escherichia coli. J. Clin. Microbiol. 33(3):701-705. <https://dx.doi.org/10.1128/jcm.33.3.701-705.1995> <PMid:7751380>
https://doi.org/10.1128/jcm.33.3.701-705... ), aggR/ipaH (Toma et al. 2003Toma C., Lu Y., Higa N., Nakasone N., Chinen I., Baschkier A., Rivas M. & Iwanaga M. 2003. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J. Clin. Microbiol. 41(6):2669-2671. <https://dx.doi.org/10.1128/JCM.41.6.2669-2671.2003> <PMid:12791900>
https://doi.org/10.1128/JCM.41.6.2669-26... ), stx1/stx2 (Paton & Paton 1998Paton A.W. & Paton J.C. 1998. Detection and characterization of Shiga Toxigenic Escherichia coli by using multiplex PCR assays for stx 1, stx 2, eaeA, Enterohemorrhagic E. coli hlyA, rfb O111, and rfb O157. J. Clin. Microbiol. 36(2):598-602. <https://dx.doi.org/10.1128/jcm.36.2.598-602.1998> <PMid:9466788>
https://doi.org/10.1128/jcm.36.2.598-602... ), est (Aranda et al. 2007Aranda K.R.S., Fabbricotti S.H., fa*gundes-Neto U. & Scaletsky I.C.A. 2007. Single multiplex assay to identify simultaneously enteropathogenic, enteroaggregative, enterotoxigenic, enteroinvasive, and Shiga toxin-producing Escherichia coli strains in Brazilian children. FEMS Microbiol. Lett. 267(2):145-150. <https://dx.doi.org/10.1111/j.1574-6968.2006.00580.x> <PMid:17328113>
https://doi.org/10.1111/j.1574-6968.2006... ) and eltA (Schultsz et al. 1994Schultsz C., Pool G.J., van Ketel R., Wever B., Speelman P. & Dankert J. 1994. Detection of Enterotoxigenic Escherichia coli in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR. J. Clin. Microbiol. 32(10):2393-2397. <https://dx.doi.org/10.1128/jcm.32.10.2393-2397.1994> <PMid:7814472>
https://doi.org/10.1128/jcm.32.10.2393-2... ). The reactions were performed according to the references cited in Table 1.
Table 1.
Virulence genes and primer sequences used in PCR reactions to investigate virulence factors in diarrheagenic Escherichia coli
Identification of isolates
A total of 12 (6.07%) from the 198 milk samples from cows with clinical mastitis had growth greater than three CFU on MacConkey agar, and Escherichia coli was identified in these samples.
Susceptibility to antibiotics
The frequency of susceptibility for each antimicrobial and classes used in the disc-diffusion test is available in Table 2. Despite the low number of isolates, the susceptibility test results to antimicrobial agents showed that 25% (3/12) of the strains exhibited resistance to at least one of the eleven antimicrobials used. Ampicillin, cefepime, cefoxitin, ceftazidime, ceftiofur, aztreonam, and gentamicin were the antimicrobials to which all strains displayed susceptibility. Intermediate resistance to streptomycin was observed in 25% (3/12) of the strains. There was resistance to cefotaxime at 8.33% (1/12), streptomycin at 16.67% (2/12), and tetracycline at 16.67% (2/12).
Table 2.
In vitro sensitivity profile (disc diffusion method) in Escherichia coli strains isolated from individual samples of cows with clinical mastitis
Disc-diffusion test for investigation of extended-spectrum β-lactamase-producing E. coli (ESBL)
None of the 12 isolates submitted to the disc-diffusion test for investigating extended-spectrum β-lactamase-producing E. coli presented the phenotypic characteristic.
Molecular characterization of E. coli isolates
Only the bfpB and escN genes, which encode virulence factors associated with the atypical EPEC pathotype of DEC, were observed in a single strain. In contrast, the eae, aggR, stx1, stx2, eltA, est, ipaH, aatA genes were absent in any of the 12 DEC isolates.
Bovine mastitis is one of the most impactful and costly diseases in dairy production, with bacterial infections being one of the most prevalent causes. The present study aimed to perform the phenotypic and genotypic characterization of Escherichia coli isolates from individual raw milk samples from cows with clinical mastitis in five regions of Brazil. In this study, we observed the prevalence of E. coli in cows with clinical mastitis at a rate of 6.07%, which is higher compared to the rate of 4.5% reported by Orsi et al. (2023)Orsi H., Guimarães F.F., Leite D.S., Guerra S.T., Joaquim S.F., Pantoja J.C.F., Hernandes R.T., Lucheis S.B., Ribeiro M.G., Langoni H. & Rall V.L.M. 2023. Characterization of mammary pathogenic Escherichia coli reveals the diversity of Escherichia coli isolates associated with bovine clinical mastitis in Brazil. J. Dairy Sci. 106(2):1403-1413. <https://dx.doi.org/10.3168/jds.2022-22126> <PMid:36567244>
https://doi.org/10.3168/jds.2022-22126... and approximately equal to the rate of 6.9% mentioned by Oliveira et al. (2022)Oliveira R.P., Aragão B.B., Melo R.P.B., Silva D.M.S., Carvalho R.G., Juliano M.A., Farias M.P.O., Lira N.S.C. & Mota R.A. 2022. Bovine mastitis in northeastern Brazil: occurrence of emergent bacteria and their phenotypic and genotypic profile of antimicrobial resistance. Comp. Immunol. Microbiol. Infect. Dis. 85:101802. <https://dx.doi.org/10.1016/j.cimid.2022.101802> <PMid:35395518>
https://doi.org/10.1016/j.cimid.2022.101... . Lactating cows are susceptible to mastitis caused by E. coli, and the numbers demonstrate the relevance of this microorganism in the cases that this form of mastitis presents.
In the early lactation phase, the mammary gland is colonized by E. coli, which is considered one of the main etiological agents of environmental clinical mastitis. Infections caused by E. coli may present mild, moderate, or severe symptoms. Several virulence factors influence this classification, including genes encoding toxins, adhesion proteins, invasives, biofilm formation, and the ability to eliminate iron and resist serum complement. However, because it causes endotoxic shock, induces apoptosis of the mammary gland, and causes a higher degree of pain, lipopolysaccharides (LPS) are considered the main virulence factor of E. coli (Chen et al. 2017Chen W., Liu Y., Yin J., Deng Y., Ali T., Zhang J., Cheng J., Rahman S.U., Gao J. & Han B. 2017. Cloning, expression, and immunogenicity of fimbrial-f17a subunit vaccine against Escherichia coli isolated from bovine mastitis. Biomed Res. Int. 2017:3248483. <https://dx.doi.org/10.1155/2017/3248483> <PMid:29333439>
https://doi.org/10.1155/2017/3248483... , Steele et al. 2019Steele N.M., Swartz T.H., Enger K.M., Schramm H., co*ckrum R.R., Lacy-Hulbert S.J., White R.R., Hogan J. & Petersson-Wolfe C.S. 2019. The effect of J5 bacterins on clinical, behavioral, and antibody response following an Escherichia coli intramammary challenge in dairy cows at peak lactation. J. Dairy Sci. 102(12):11233-11249. <https://dx.doi.org/10.3168/jds.2019-16549> <PMid:31606213>
https://doi.org/10.3168/jds.2019-16549... ).
Despite regulatory and structural changes in milk production, the prevalence of resistant Gram-negative microorganisms, such as E. coli, has steadily increased in cases of mastitis, causing serious public health problems (Bandyopadhyay et al. 2015Bandyopadhyay S., Samanta I., Bhattacharyya D., Nanda P.K., Kar D., Chowdhury J., Dandapat P., Das A.K., Batul N., Mondal B., Dutta T.K., Das G., Das B.C., Naskar S., Bandyopadhyay U.K., Das S.C. & Bandyopadhyay S. 2015. Co-infection of methicillin-resistant Staphylococcus epidermidis, methicillin-resistant Staphylococcus aureus, and extended spectrum β-lactamase producing Escherichia coli in bovine mastitis - three cases reported from India. Vet. Q. 35(1):56-61. <https://dx.doi.org/10.1080/01652176.2014.984365> <PMid:25444074>
https://doi.org/10.1080/01652176.2014.98... ). The indiscriminate use of antimicrobials in mastitis treatment has become a worldwide concern due to favoring the occurrence of the resistance process (Ahmed & Shimamoto 2011Ahmed A.M. & Shimamoto T. 2011. Molecular characterization of antimicrobial resistance in Gram-negative bacteria isolated from bovine mastitis in Egypt. Microbiol. Immunol. 55(5):318-327. <https://dx.doi.org/10.1111/j.1348-0421.2011.00323.x> <PMid:21338385>
https://doi.org/10.1111/j.1348-0421.2011... ). In this study, the antimicrobial susceptibility test revealed that E. coli isolates in individual milk samples with clinical mastitis showed greater resistance to cefotaxime at about 8.33% and streptomycin and tetracycline at about 16.67%. Similarly, other studies have shown a higher resistance in E. coli isolates to streptomycin and tetracycline; however, it is worth noting that our study involves a smaller number of isolates (Bandyopadhyay et al. 2015Bandyopadhyay S., Samanta I., Bhattacharyya D., Nanda P.K., Kar D., Chowdhury J., Dandapat P., Das A.K., Batul N., Mondal B., Dutta T.K., Das G., Das B.C., Naskar S., Bandyopadhyay U.K., Das S.C. & Bandyopadhyay S. 2015. Co-infection of methicillin-resistant Staphylococcus epidermidis, methicillin-resistant Staphylococcus aureus, and extended spectrum β-lactamase producing Escherichia coli in bovine mastitis - three cases reported from India. Vet. Q. 35(1):56-61. <https://dx.doi.org/10.1080/01652176.2014.984365> <PMid:25444074>
https://doi.org/10.1080/01652176.2014.98... , Tadesse et al. 2018Tadesse H.A., Gidey N.B., Workelule K., Hailu H., Gidey S., Bsrat A. & Taddele H. 2018. Antimicrobial resistance profile of E. coli isolated from raw cow milk and fresh fruit juice in Mekelle, Tigray, Ethiopia. Vet. Med. Int. 2018:8903142. <https://dx.doi.org/10.1155/2018/8903142> <PMid:29755727>
https://doi.org/10.1155/2018/8903142... , Messele et al. 2019Messele Y.E., Abdi R.D., Tegegne D.T., Bora S.K., Babura M.D., Emeru B.A. & Werid G.M. 2019. Analysis of milk-derived isolates of E. coli indicating drug resistance in central Ethiopia. Trop. Anim. Health Prod. 51(3):661-667. <https://dx.doi.org/10.1007/s11250-018-1737-x> <PMid:30357604>
https://doi.org/10.1007/s11250-018-1737-... ).
Cephalosporins, aminoglycosides, and tetracyclines are widely used in veterinary medicine, including in treating bovine bacterial mastitis. ESBL-producing E. coli can attribute resistance to cephalosporins through the hydrolysis of these antimicrobials. In contrast, tetracycline resistance occurs through ribosomal protection and efflux pumping, both associated with the tet gene, which triggers antimicrobial resistance to tetracyclines (Pereira et al. 2011Pereira R.V.V., Santos T.M.A., Bicalho M.L., Caixeta L.S., Machado V.S. & Bicalho R.C. 2011. Antimicrobial resistance and prevalence of virulence factor genes in fecal Escherichia coli of Holstein calves fed milk with and without antimicrobials. J. Dairy Science 94(9):4556-4565. <https://dx.doi.org/10.3168/jds.2011-4337> <PMid:21854928>
https://doi.org/10.3168/jds.2011-4337... ).
The treatment of clinical mastitis cases should be based on the type of etiological agent and antimicrobial sensitivity. Farm culture systems have been widely employed in identifying infectious agents of mastitis before determining a therapeutic approach (McDougall et al. 2018McDougall S., Niethammer J. & Graham E.M. 2018. Antimicrobial usage and risk of retreatment for mild to moderate clinical mastitis cases on dairy farms following on-farm bacterial culture and selective therapy. N. Z. Vet. J. 66(2):98-107. <https://dx.doi.org/10.1080/00480169.2017.1416692> <PMid:29241025>
https://doi.org/10.1080/00480169.2017.14... , Sipka et al. 2021Sipka A., Wieland M., Biscarini F., Rossi R.M., Roman N., Santisteban C., Moroni P., Nydam D.V. 2021. Short communication: Comparative performance of 3 on-farm culture systems for detection of mastitis pathogens interpreted by trained and untrained observers. J. Dairy Sci. 104(4):4936-4941. <https://dx.doi.org/10.3168/jds.2020-19166> <PMid:33612204>
https://doi.org/10.3168/jds.2020-19166... ). Implementing culture systems on the farm minimizes the indiscriminate use of antibiotics, establishing antibiotic therapy only in cases of positive breast quarters and with chances of cure (Cameron et al. 2014Cameron M., McKenna S.L., MacDonald K.A., Dohoo I.R., Roy J.P. & Keefe G.P. 2014. Evaluation of selective dry cow treatment following on-farm culture: Risk of post-calving intramammary infection and clinical mastitis in the subsequent lactation. J. Dairy Sci. 97(1):270-284. <https://dx.doi.org/10.3168/jds.2013-7060> <PMid:24183691>
https://doi.org/10.3168/jds.2013-7060... ).
The highest susceptibility of isolates to antimicrobials (>100%) studied was observed for ampicillin, cefepime, cefoxitin, ceftazidime, ceftiofur, aztreonam, and gentamicin, indicating that mainly cephalosporins should be considered in the treatment of cases of intramammary infections (IMI) by E. coli (Tomazi et al. 2018Tomazi T., Coura F.M., Gonçalves J.L., Heinemann M.B. & Santos M.V. 2018. Antimicrobial susceptibility patterns of Escherichia coli phylogenetic groups isolated from bovine clinical mastitis. J. Dairy Sci. 101(10):9406-9418. <https://dx.doi.org/10.3168/jds.2018-14485> <PMid:30031577>
https://doi.org/10.3168/jds.2018-14485... ).
None of the E. coli isolates evaluated in this study presented phenotypic characteristics for producing extended-spectrum β-lactamase (ESBL). However, considering the indiscriminate use of antimicrobials in the treatment of mastitis, a certain frequency of ESBL-producing E. coli in raw milk is expected (Saei et al. 2022Saei M., Jamshidi A., Zeinali T. & Khoramian B. 2022. Phenotypic and genotypic determination of β-lactamase-producing Escherichia coli strains isolated from raw milk and clinical mastitis samples, Mashhad, Iran. Int. Dairy J. 133:105406. <https://dx.doi.org/10.1016/j.idairyj.2022.105406>
https://doi.org/10.1016/j.idairyj.2022.1... ). Other studies reported a higher prevalence in identifying isolates of ESBL-producing E. coli in milk samples, these being 3.42% and 21.56%, respectively (Parussolo et al. 2019Parussolo L., Sfaciotte R.A.P., Dalmina K.A., Melo F.D., Costa U.M. & Ferraz S.M. 2019. Detecção de genes de virulência e perfis de resistência antimicrobiana de Escherichia coli isoladas de leite cru e queijo artesanal no Sul do Brasil. Semina, Ciênc. Agrárias 40(1):163-178. <https://dx.doi.org/10.5433/1679-0359.2019v40n1p163>
https://doi.org/10.5433/1679-0359.2019v4... , Saei et al. 2022Saei M., Jamshidi A., Zeinali T. & Khoramian B. 2022. Phenotypic and genotypic determination of β-lactamase-producing Escherichia coli strains isolated from raw milk and clinical mastitis samples, Mashhad, Iran. Int. Dairy J. 133:105406. <https://dx.doi.org/10.1016/j.idairyj.2022.105406>
https://doi.org/10.1016/j.idairyj.2022.1... ).
This study investigated the main genes associated with DEC virulence factors in E. coli isolates. The occurrence of DEC in milk samples with clinical mastitis from different regions of Brazil is unknown. All isolates tested negative for the eae, aatA, aggR, ipaH, stx1, stx2, est, and eltA genes, with only one positive isolate for the bfpB and escN genes. The non-identification of genes such as stx in isolates is in accordance with Bag et al. (2021)Bag M.A.S., Khan M.S.R., Sami M.D.H., Begum F., Islam M.S., Rahman M.M., Rahman M.T. & Hassan J. 2021. Virulence determinants and antimicrobial resistance of E. coli isolated from bovine clinical mastitis in some selected dairy farms of Bangladesh. Saudi J. Biol. Sci. 28(11):6317-6323. <https://dx.doi.org/10.1016/j.sjbs.2021.06.099> <PMid:34759751>
https://doi.org/10.1016/j.sjbs.2021.06.0... and Lan et al. (2020)Lan T., Liu H., Meng L., Xing M., Dong L., Gu M., Wang J. & Zheng N. 2020. Antimicrobial susceptibility, phylotypes, and virulence genes of Escherichia coli from clinical bovine mastitis in five provinces of China. Food Agric. Immunol. 31(1):406-423. <https://dx.doi.org/10.1080/09540105.2020.1736009>
https://doi.org/10.1080/09540105.2020.17... . However, the occurrence of these genes in E. coli has been reported in clinical mastitis cases by other authors (Lan et al. 2020Lan T., Liu H., Meng L., Xing M., Dong L., Gu M., Wang J. & Zheng N. 2020. Antimicrobial susceptibility, phylotypes, and virulence genes of Escherichia coli from clinical bovine mastitis in five provinces of China. Food Agric. Immunol. 31(1):406-423. <https://dx.doi.org/10.1080/09540105.2020.1736009>
https://doi.org/10.1080/09540105.2020.17... , Bag et al. 2021Bag M.A.S., Khan M.S.R., Sami M.D.H., Begum F., Islam M.S., Rahman M.M., Rahman M.T. & Hassan J. 2021. Virulence determinants and antimicrobial resistance of E. coli isolated from bovine clinical mastitis in some selected dairy farms of Bangladesh. Saudi J. Biol. Sci. 28(11):6317-6323. <https://dx.doi.org/10.1016/j.sjbs.2021.06.099> <PMid:34759751>
https://doi.org/10.1016/j.sjbs.2021.06.0... ). Although the association between virulence genes and the severity of clinical mastitis cases is not well elucidated, the presence of the bfpB and escN genes may contribute to clinical mastitis caused by DEC. Therefore, many samples are needed to investigate the presence of virulence genes associated with DEC pathotypes in E. coli isolates from individual milk samples with clinical mastitis in various states of Brazil. However, these preliminary results suggest a low number of bovine clinical mastitis cases caused by DEC.
Based on the presented results, we identified Escherichia coli in 6.07% of milk samples from cows with clinical mastitis. The antibiotic susceptibility analysis revealed that 25% of the strains showed resistance to at least one of the eleven tested antimicrobials. However, it is crucial to highlight that none of the isolates subjected to the disk diffusion test for extended-spectrum β-lactamase-producing E. coli (ESBL) presented this phenotypic characteristic. Additionally, the bfpB and escN genes, associated with the atypical enteropathogenic E. coli (EPEC) pathotype of diarrheagenic E. coli (DEC), were detected in only one strain. In contrast, other virulence genes, such as eae, aggR, stx1, stx2, eltA, est, ipaH, and aatA, were absent in all 12 DEC isolates.
These results suggest a low prevalence of bovine clinical mastitis cases caused by DEC despite the presence of resistance to some antimicrobials. The absence of ESBL isolates is optimistic regarding resistance to broad-spectrum β-lactams. However, there is a continued need for surveillance and comprehensive studies to understand the epidemiology and antimicrobial resistance in E. coli strains associated with bovine clinical mastitis.
This study was funded by the “Fundação Coordenação de Aperfeiçoamento de Pessoal de Nível Superior” (CAPES), Brazil, Financial Code 001, and by the “Fundação de Amparo à Pesquisa do Estado de São Paulo” (FAPESP), grant 2019/17308-4. The authors would also like to thank the team involved in the project FAPESP 2019/17308-4, Dr. Rodrigo Hernandes, and the collaborators at the Laboratory of Bacterial Toxins I and II at the Faculty of Food Engineering at Unicamp.
Addis M.F., Maffioli E.M., Ceciliani F., Tedeschi G., Zamarian V., Tangorra F., Albertini M., Piccinini R. & Bronzo V. 2020. Influence of subclinical mastitis and intramammary infection by coagulase-negative staphylococci on the cow milk peptidome. J. Proteomics 226:103885. <https://dx.doi.org/10.1016/j.jprot.2020.103885> <PMid:32645476>
» https://doi.org/10.1016/j.jprot.2020.103885Adkins P.R.F. & Middleton J.R. 2018. Methods for diagnosing mastitis. Vet. Clin. N. Am., Food Anim. Pract. 34(3):479-491. <https://dx.doi.org/10.1016/j.cvfa.2018.07.003> <PMid:30316505>
» https://doi.org/10.1016/j.cvfa.2018.07.003Ahmed A.M. & Shimamoto T. 2011. Molecular characterization of antimicrobial resistance in Gram-negative bacteria isolated from bovine mastitis in Egypt. Microbiol. Immunol. 55(5):318-327. <https://dx.doi.org/10.1111/j.1348-0421.2011.00323.x> <PMid:21338385>
» https://doi.org/10.1111/j.1348-0421.2011.00323.xAranda K.R.S., Fabbricotti S.H., fa*gundes-Neto U. & Scaletsky I.C.A. 2007. Single multiplex assay to identify simultaneously enteropathogenic, enteroaggregative, enterotoxigenic, enteroinvasive, and Shiga toxin-producing Escherichia coli strains in Brazilian children. FEMS Microbiol. Lett. 267(2):145-150. <https://dx.doi.org/10.1111/j.1574-6968.2006.00580.x> <PMid:17328113>
» https://doi.org/10.1111/j.1574-6968.2006.00580.xBag M.A.S., Khan M.S.R., Sami M.D.H., Begum F., Islam M.S., Rahman M.M., Rahman M.T. & Hassan J. 2021. Virulence determinants and antimicrobial resistance of E. coli isolated from bovine clinical mastitis in some selected dairy farms of Bangladesh. Saudi J. Biol. Sci. 28(11):6317-6323. <https://dx.doi.org/10.1016/j.sjbs.2021.06.099> <PMid:34759751>
» https://doi.org/10.1016/j.sjbs.2021.06.099Bandyopadhyay S., Samanta I., Bhattacharyya D., Nanda P.K., Kar D., Chowdhury J., Dandapat P., Das A.K., Batul N., Mondal B., Dutta T.K., Das G., Das B.C., Naskar S., Bandyopadhyay U.K., Das S.C. & Bandyopadhyay S. 2015. Co-infection of methicillin-resistant Staphylococcus epidermidis, methicillin-resistant Staphylococcus aureus, and extended spectrum β-lactamase producing Escherichia coli in bovine mastitis - three cases reported from India. Vet. Q. 35(1):56-61. <https://dx.doi.org/10.1080/01652176.2014.984365> <PMid:25444074>
» https://doi.org/10.1080/01652176.2014.984365Bauer A.W., Kirby W.M.M., Sherris J.C. & Turck M. 1966. Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 45(4):493-496. <https://dx.doi.org/10.1093/ajcp/45.4_ts.493>
» https://doi.org/10.1093/ajcp/45.4_ts.493Cameron M., McKenna S.L., MacDonald K.A., Dohoo I.R., Roy J.P. & Keefe G.P. 2014. Evaluation of selective dry cow treatment following on-farm culture: Risk of post-calving intramammary infection and clinical mastitis in the subsequent lactation. J. Dairy Sci. 97(1):270-284. <https://dx.doi.org/10.3168/jds.2013-7060> <PMid:24183691>
» https://doi.org/10.3168/jds.2013-7060Chen W., Liu Y., Yin J., Deng Y., Ali T., Zhang J., Cheng J., Rahman S.U., Gao J. & Han B. 2017. Cloning, expression, and immunogenicity of fimbrial-f17a subunit vaccine against Escherichia coli isolated from bovine mastitis. Biomed Res. Int. 2017:3248483. <https://dx.doi.org/10.1155/2017/3248483> <PMid:29333439>
» https://doi.org/10.1155/2017/3248483Clermont O., Dixit O.V.A., Vangchhia B., Condamine B., Dion S., Bridier-Nahmias A., Denamur E. & Gordon D. 2019. Characterization and rapid identification of phylogroup G in Escherichia coli, a lineage with high virulence and antibiotic resistance potential. Environ. Microbiol. 21(8):3107-3117. <https://dx.doi.org/10.1111/1462-2920.14713> <PMid:31188527>
» https://doi.org/10.1111/1462-2920.14713CLSI 2022. M100 Performance Standards for Antimicrobial Susceptibility Testing. 32nd ed. Clinical and Laboratory Standards Institute.
Dias R.C.B., Dos Santos B.C., Dos Santos L.F., Vieira M.A., Yamatogi R.S., Mondelli A.L., Sadatsune T., Sforcin J.M., Gomes T.A.T. & Hernandes R.T. 2016. Diarrheagenic Escherichia coli pathotypes investigation revealed atypical enteropathogenic E. coli as putative emerging diarrheal agents in children living in Botucatu, São Paulo State, Brazil. Apmis 124(4):299-308. <https://dx.doi.org/10.1111/apm.12501> <PMid:26752102>
» https://doi.org/10.1111/apm.12501Down P.M., Bradley A.J., Breen J.E. & Green M.J. 2017. Factors affecting the cost-effectiveness of on-farm culture prior to the treatment of clinical mastitis in dairy cows. Prev. Vet. Med. 145:91-99. <https://dx.doi.org/10.1016/j.prevetmed.2017.07.006> <PMid:28903881>
» https://doi.org/10.1016/j.prevetmed.2017.07.006Down P.M., Green M.J. & Hudson C.D. 2013. Rate of transmission: A major determinant of the cost of clinical mastitis. J. Dairy Sci. 96(10):6301-6314. <https://dx.doi.org/10.3168/jds.2012-6470> <PMid:23958003>
» https://doi.org/10.3168/jds.2012-6470Hernandes R.T., Elias W.P., Vieira M.A. & Gomes T.A. 2009. An overview of atypical enteropathogenic Escherichia coli FEMS Microbiol. Letters 297(2):137-149. <https://dx.doi.org/10.1111/j.1574-6968.2009.01664.x> <PMid:19527295>
» https://doi.org/10.1111/j.1574-6968.2009.01664.xKoneman E.W.A.S. 1997. The Gram Positive Cocci: Staphylococci and related organism, p.253-320. In: Koneman E.W., Allen S.D., Janda W.M., Schreckenberger P.C. & Winn W.C. (Eds), Color Atlas and Textbook of Diagnostic Microbiology. 5th ed. Lippincott Williams and Wilkins, Philadelphia.
Lan T., Liu H., Meng L., Xing M., Dong L., Gu M., Wang J. & Zheng N. 2020. Antimicrobial susceptibility, phylotypes, and virulence genes of Escherichia coli from clinical bovine mastitis in five provinces of China. Food Agric. Immunol. 31(1):406-423. <https://dx.doi.org/10.1080/09540105.2020.1736009>
» https://doi.org/10.1080/09540105.2020.1736009Leimbach A., Poehlein A., Vollmers J., Görlich D., Daniel R. & Dobrindt U. 2017. No evidence for a bovine mastitis Escherichia coli pathotype. BMC Genomics 18:359. <https://dx.doi.org/10.1186/s12864-017-3739-x> <PMid:28482799>
» https://doi.org/10.1186/s12864-017-3739-xMacFaddin J.F. 2000. Biochemical Tests for Identification of Medical Bacteria. 3rd ed. Lippincott Williams & Wilkins, Philadelphia. 912p.
Mahmmod Y.S., Nonnemann B., Svennesen L., Pedersen K. & Klaas I.C. 2018. Typeability of MALDI-TOF assay for identification of non-aureus staphylococci associated with bovine intramammary infections and teat apex colonization. J. Dairy Sci. 101(10):9430-9438. <https://dx.doi.org/10.3168/jds.2018-14579> <PMid:30100507>
» https://doi.org/10.3168/jds.2018-14579McDougall S., Niethammer J. & Graham E.M. 2018. Antimicrobial usage and risk of retreatment for mild to moderate clinical mastitis cases on dairy farms following on-farm bacterial culture and selective therapy. N. Z. Vet. J. 66(2):98-107. <https://dx.doi.org/10.1080/00480169.2017.1416692> <PMid:29241025>
» https://doi.org/10.1080/00480169.2017.1416692Messele Y.E., Abdi R.D., Tegegne D.T., Bora S.K., Babura M.D., Emeru B.A. & Werid G.M. 2019. Analysis of milk-derived isolates of E. coli indicating drug resistance in central Ethiopia. Trop. Anim. Health Prod. 51(3):661-667. <https://dx.doi.org/10.1007/s11250-018-1737-x> <PMid:30357604>
» https://doi.org/10.1007/s11250-018-1737-xMüller D., Greune L., Heusipp G., Karch H., Fruth A., Tschäpe H. & Schmidt M.A. 2007. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 73(10):3380-3390. <http://dx.doi.org/10.1128/aem.02855-06> <PMid:17400780>
» https://doi.org/http://dx.doi.org/10.1128/aem.02855-06Nagy B., Szmolka A., Smole Možina S., Kovač J., Strauss A., Schlager S., Beutlich J., Appel B., Lušicky M., Aprikian P., Pászti J., Tóth I., Kugler R. & Wagner M. 2015. Virulence and antimicrobial resistance determinants of verotoxigenic Escherichia coli (VTEC) and of multidrug-resistant E. coli from foods of animal origin illegally imported to the EU by flight passengers. Int. J. Food Microbiol. 209:52-59. <https://dx.doi.org/10.1016/j.ijfoodmicro.2015.06.026> <PMid:26148965>
» https://doi.org/10.1016/j.ijfoodmicro.2015.06.026Oliveira R.P., Aragão B.B., Melo R.P.B., Silva D.M.S., Carvalho R.G., Juliano M.A., Farias M.P.O., Lira N.S.C. & Mota R.A. 2022. Bovine mastitis in northeastern Brazil: occurrence of emergent bacteria and their phenotypic and genotypic profile of antimicrobial resistance. Comp. Immunol. Microbiol. Infect. Dis. 85:101802. <https://dx.doi.org/10.1016/j.cimid.2022.101802> <PMid:35395518>
» https://doi.org/10.1016/j.cimid.2022.101802Orsi H., Guimarães F.F., Leite D.S., Guerra S.T., Joaquim S.F., Pantoja J.C.F., Hernandes R.T., Lucheis S.B., Ribeiro M.G., Langoni H. & Rall V.L.M. 2023. Characterization of mammary pathogenic Escherichia coli reveals the diversity of Escherichia coli isolates associated with bovine clinical mastitis in Brazil. J. Dairy Sci. 106(2):1403-1413. <https://dx.doi.org/10.3168/jds.2022-22126> <PMid:36567244>
» https://doi.org/10.3168/jds.2022-22126Parussolo L., Sfaciotte R.A.P., Dalmina K.A., Melo F.D., Costa U.M. & Ferraz S.M. 2019. Detecção de genes de virulência e perfis de resistência antimicrobiana de Escherichia coli isoladas de leite cru e queijo artesanal no Sul do Brasil. Semina, Ciênc. Agrárias 40(1):163-178. <https://dx.doi.org/10.5433/1679-0359.2019v40n1p163>
» https://doi.org/10.5433/1679-0359.2019v40n1p163Paton A.W. & Paton J.C. 1998. Detection and characterization of Shiga Toxigenic Escherichia coli by using multiplex PCR assays for stx 1, stx 2, eaeA, Enterohemorrhagic E. coli hlyA, rfb O111, and rfb O157 J. Clin. Microbiol. 36(2):598-602. <https://dx.doi.org/10.1128/jcm.36.2.598-602.1998> <PMid:9466788>
» https://doi.org/10.1128/jcm.36.2.598-602.1998Pereira R.V.V., Santos T.M.A., Bicalho M.L., Caixeta L.S., Machado V.S. & Bicalho R.C. 2011. Antimicrobial resistance and prevalence of virulence factor genes in fecal Escherichia coli of Holstein calves fed milk with and without antimicrobials. J. Dairy Science 94(9):4556-4565. <https://dx.doi.org/10.3168/jds.2011-4337> <PMid:21854928>
» https://doi.org/10.3168/jds.2011-4337Quinn P.J., Markey B.K, Carter M.E., Donnelly W.J. & Leonard F.C. 2005. Microbiologia Veterinária e Doenças Infecciosas. Artmed, São Paulo. 512p.
Reid S.D., Betting D.J. & Whittam T.S. 1999. Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR. J. Clin. Microbiol. 37(8):2719-2722. <https://dx.doi.org/10.1128/jcm.37.8.2719-2722.1999> <PMid:10405431>
» https://doi.org/10.1128/jcm.37.8.2719-2722.1999Saei M., Jamshidi A., Zeinali T. & Khoramian B. 2022. Phenotypic and genotypic determination of β-lactamase-producing Escherichia coli strains isolated from raw milk and clinical mastitis samples, Mashhad, Iran. Int. Dairy J. 133:105406. <https://dx.doi.org/10.1016/j.idairyj.2022.105406>
» https://doi.org/10.1016/j.idairyj.2022.105406Schmidt H., Knop C., Franke S., Aleksic S., Heesemann J. & Karch H. 1995. Development of PCR for screening of enteroaggregative Escherichia coli J. Clin. Microbiol. 33(3):701-705. <https://dx.doi.org/10.1128/jcm.33.3.701-705.1995> <PMid:7751380>
» https://doi.org/10.1128/jcm.33.3.701-705.1995Schultsz C., Pool G.J., van Ketel R., Wever B., Speelman P. & Dankert J. 1994. Detection of Enterotoxigenic Escherichia coli in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR. J. Clin. Microbiol. 32(10):2393-2397. <https://dx.doi.org/10.1128/jcm.32.10.2393-2397.1994> <PMid:7814472>
» https://doi.org/10.1128/jcm.32.10.2393-2397.1994Silva N., Junqueira V.C.A. & Silveira N.F.A. 2001. Manual de Métodos de Análise Microbiológica de Alimentos. 2ª ed. Varela, São Paulo. 295p.
Sipka A., Wieland M., Biscarini F., Rossi R.M., Roman N., Santisteban C., Moroni P., Nydam D.V. 2021. Short communication: Comparative performance of 3 on-farm culture systems for detection of mastitis pathogens interpreted by trained and untrained observers. J. Dairy Sci. 104(4):4936-4941. <https://dx.doi.org/10.3168/jds.2020-19166> <PMid:33612204>
» https://doi.org/10.3168/jds.2020-19166Steele N.M., Swartz T.H., Enger K.M., Schramm H., co*ckrum R.R., Lacy-Hulbert S.J., White R.R., Hogan J. & Petersson-Wolfe C.S. 2019. The effect of J5 bacterins on clinical, behavioral, and antibody response following an Escherichia coli intramammary challenge in dairy cows at peak lactation. J. Dairy Sci. 102(12):11233-11249. <https://dx.doi.org/10.3168/jds.2019-16549> <PMid:31606213>
» https://doi.org/10.3168/jds.2019-16549Steimle A., Autenrieth I.B. & Frick J.-S. 2016. Structure and function: Lipid A modifications in commensals and pathogens. Int. J. Med. Microbiol. 306(5):290-301. <https://dx.doi.org/10.1016/j.ijmm.2016.03.001> <PMid:27009633>
» https://doi.org/10.1016/j.ijmm.2016.03.001Tadesse H.A., Gidey N.B., Workelule K., Hailu H., Gidey S., Bsrat A. & Taddele H. 2018. Antimicrobial resistance profile of E. coli isolated from raw cow milk and fresh fruit juice in Mekelle, Tigray, Ethiopia. Vet. Med. Int. 2018:8903142. <https://dx.doi.org/10.1155/2018/8903142> <PMid:29755727>
» https://doi.org/10.1155/2018/8903142Toma C., Lu Y., Higa N., Nakasone N., Chinen I., Baschkier A., Rivas M. & Iwanaga M. 2003. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli J. Clin. Microbiol. 41(6):2669-2671. <https://dx.doi.org/10.1128/JCM.41.6.2669-2671.2003> <PMid:12791900>
» https://doi.org/10.1128/JCM.41.6.2669-2671.2003Tomazi T., Coura F.M., Gonçalves J.L., Heinemann M.B. & Santos M.V. 2018. Antimicrobial susceptibility patterns of Escherichia coli phylogenetic groups isolated from bovine clinical mastitis. J. Dairy Sci. 101(10):9406-9418. <https://dx.doi.org/10.3168/jds.2018-14485> <PMid:30031577>
» https://doi.org/10.3168/jds.2018-14485Trabulsi L.R., Alterthum F., Martinez M.B., Campos L.C., Gompertz O.F., Rácz M.L., Ventura A.M., Corrêa B., Mendes C.M.F., Taddei C.R., Menck C.F.M., Menezes C.A., Vaz C.A.C., Paula C.R., Moreira C.G., Santos D.S., Mehnert D.U., Padilla G., Fernandez H., Resque H.R., Mímica I.M., Gutierrez Rivera I.N., Kotait I., Candeias J.A.N., Ordoñez J.G., Castilho J.G., Avelar K.E.S., Santos K.R.N., Sircili M.P., Teixeira L.M., Mímica L.M.J., Basso L.A., Sampaio M.C., Franzolin M.R., Ferreira M.C.S., Carvalhal M.L., Carrieri M.L., Domingos M.O., Pereira M.M., Barreto M.L., Uzeda M., Lincopan N., Sant’Anna O.A., Duarte R.S., Domingues R.M.C.P., Ducati R.G., Piazza R.M.F., Costa S.O.P., Gomes T.A.T., Bueris V., Mundford V., Elias Junior W.P. & Gambale W. 2004. Microbiologia. Atheneu, São Paulo. 718p.
Zhang D., Zhang Z., Huang C., Gao X., Wang Z., Liu Y., Tian C., Hong W., Niu S. & Liu M. 2018. The phylogenetic group, antimicrobial susceptibility, and virulence genes of Escherichia coli from clinical bovine mastitis. J. Dairy Sci. 101(1):572-580. <https://dx.doi.org/10.3168/jds.2017-13159> <PMid:29055550>
» https://doi.org/10.3168/jds.2017-13159
- Publication in this collection
31May2024 - Date of issue
2024
- Received
09Jan2024 - Accepted
23Feb2024
Authorship
Erik da S. Pereira
Departamento de Ciência de Alimentos e Nutrição, Faculdade de Engenharia de Alimentos (FEA), Universidade Estadual de Campinas (Unicamp), Campinas, SP 13083-862, Brazil.
Bruna L. Crippa
Departamento de Ciência de Alimentos e Nutrição, Faculdade de Engenharia de Alimentos (FEA), Universidade Estadual de Campinas (Unicamp), Campinas, SP 13083-862, Brazil.
Rafaela M. Morasi
Departamento de Ciência de Alimentos e Nutrição, Faculdade de Engenharia de Alimentos (FEA), Universidade Estadual de Campinas (Unicamp), Campinas, SP 13083-862, Brazil.
Jaqueline M. de Almeida
Departamento de Ciência de Alimentos e Nutrição, Faculdade de Engenharia de Alimentos (FEA), Universidade Estadual de Campinas (Unicamp), Campinas, SP 13083-862, Brazil.
Clarice Gebara
Centro de Pesquisa em Alimentos, Escola de Veterinária e Zootecnia, Universidade Federal de Goiás (UFG), Goiânia, GO 74690-900, Brazil.
Hélio Langoni
Departamento de Produção Animal e Medicina Veterinária Preventiva, Faculdade de Medicina Veterinária e Zootecnia (FMVZ), Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Botucatu, SP 18618 681, Brazil.
André T. Neto
Universidade do Estado de Santa Catarina (UDESC), Av. Luiz de Camões, Cx. Postal 2090, Conta Dinheiro, Lages, SC 88520-000, Brazil.
Mônica C. Gonçalves
Universidade Federal de Campina Grande, Unidade Acadêmica de Tecnologia de Alimentos, Pombal, PB 58840-000, Brazil.
Nathália Cristina C. Silva **Corresponding author: [email protected]
Departamento de Ciência de Alimentos e Nutrição, Faculdade de Engenharia de Alimentos (FEA), Universidade Estadual de Campinas (Unicamp), Campinas, SP 13083-862, Brazil.
- *Corresponding author: [email protected]
-
Conflict of interest statement.- The authors declare no conflict of interest for this article.
SCIMAGO INSTITUTIONS RANKINGS
Departamento de Ciência de Alimentos e Nutrição, Faculdade de Engenharia de Alimentos (FEA), Universidade Estadual de Campinas (Unicamp), Campinas, SP 13083-862, Brazil.
Centro de Pesquisa em Alimentos, Escola de Veterinária e Zootecnia, Universidade Federal de Goiás (UFG), Goiânia, GO 74690-900, Brazil.
Departamento de Produção Animal e Medicina Veterinária Preventiva, Faculdade de Medicina Veterinária e Zootecnia (FMVZ), Universidade Estadual Paulista “Júlio de Mesquita Filho” (Unesp), Botucatu, SP 18618 681, Brazil.
Universidade do Estado de Santa Catarina (UDESC), Av. Luiz de Camões, Cx. Postal 2090, Conta Dinheiro, Lages, SC 88520-000, Brazil.
Universidade Federal de Campina Grande, Unidade Acadêmica de Tecnologia de Alimentos, Pombal, PB 58840-000, Brazil.
Tables
- Tables (2)
Table 1.
Virulence genes and primer sequences used in PCR reactions to investigate virulence factors in diarrheagenic Escherichia coli
Table 2.
In vitro sensitivity profile (disc diffusion method) in Escherichia coli strains isolated from individual samples of cows with clinical mastitis
Table 1. Virulence genes and primer sequences used in PCR reactions to investigate virulence factors in diarrheagenic Escherichia coli
Gene | Sequence (5’ → 3’) | Annealing temperature (oC) | Amplicon (pb) | Reference |
eae | F: CTGAACGGCGATTACGCGAA | 52 | 917 | Reid et al. (1999)Reid S.D., Betting D.J. & Whittam T.S. 1999. Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR. J. Clin. Microbiol. 37(8):2719-2722. <https://dx.doi.org/10.1128/jcm.37.8.2719-2722.1999> <PMid:10405431> https://doi.org/10.1128/jcm.37.8.2719-27... |
R: CGAGACGATACGATCCAG | ||||
bfpB | F: GACACCTCATTGCTGAAGTCG | 63 | 910 | Müller et al. (2007)Müller D., Greune L., Heusipp G., Karch H., Fruth A., Tschäpe H. & Schmidt M.A. 2007. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 73(10):3380-3390. <http://dx.doi.org/10.1128/aem.02855-06> <PMid:17400780> https://doi.org/http://dx.doi.org/10.112... |
R: CCAGAACACCTCCGTTATGC | ||||
aggR | F: GTATACACAAAAGAAGGAAGC | 52 | 254 | Toma et al. (2003)Toma C., Lu Y., Higa N., Nakasone N., Chinen I., Baschkier A., Rivas M. & Iwanaga M. 2003. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J. Clin. Microbiol. 41(6):2669-2671. <https://dx.doi.org/10.1128/JCM.41.6.2669-2671.2003> <PMid:12791900> https://doi.org/10.1128/JCM.41.6.2669-26... |
R: ACAGAATCGTCAGCATCAGC | ||||
stx1 | F: ATAAATCGCCATTCGTTGACTAC | 52 | 180 | Paton & Paton (1998)Paton A.W. & Paton J.C. 1998. Detection and characterization of Shiga Toxigenic Escherichia coli by using multiplex PCR assays for stx 1, stx 2, eaeA, Enterohemorrhagic E. coli hlyA, rfb O111, and rfb O157. J. Clin. Microbiol. 36(2):598-602. <https://dx.doi.org/10.1128/jcm.36.2.598-602.1998> <PMid:9466788> https://doi.org/10.1128/jcm.36.2.598-602... |
R: AGAACGCCCACTGAGATCATC | ||||
stx2 | F: GGCACTGTCTGAAACTGCTCC | 52 | 255 | Paton & Paton (1998)Paton A.W. & Paton J.C. 1998. Detection and characterization of Shiga Toxigenic Escherichia coli by using multiplex PCR assays for stx 1, stx 2, eaeA, Enterohemorrhagic E. coli hlyA, rfb O111, and rfb O157. J. Clin. Microbiol. 36(2):598-602. <https://dx.doi.org/10.1128/jcm.36.2.598-602.1998> <PMid:9466788> https://doi.org/10.1128/jcm.36.2.598-602... |
R: TCGCCAGTTATCTGACATTCTG | ||||
eltA | F: GGCGACAGATTATACCGTGC | 50 | 696 | Schultsz et al. (1994)Schultsz C., Pool G.J., van Ketel R., Wever B., Speelman P. & Dankert J. 1994. Detection of Enterotoxigenic Escherichia coli in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR. J. Clin. Microbiol. 32(10):2393-2397. <https://dx.doi.org/10.1128/jcm.32.10.2393-2397.1994> <PMid:7814472> https://doi.org/10.1128/jcm.32.10.2393-2... |
R: CCGAATTCTGTTATATATGTC | ||||
est | F: ATTTTTMTTTCTGTATTRTCTT | 52 | 190 | Aranda et al. (2007)Aranda K.R.S., Fabbricotti S.H., fa*gundes-Neto U. & Scaletsky I.C.A. 2007. Single multiplex assay to identify simultaneously enteropathogenic, enteroaggregative, enterotoxigenic, enteroinvasive, and Shiga toxin-producing Escherichia coli strains in Brazilian children. FEMS Microbiol. Lett. 267(2):145-150. <https://dx.doi.org/10.1111/j.1574-6968.2006.00580.x> <PMid:17328113> https://doi.org/10.1111/j.1574-6968.2006... |
R: CACCCGGTACARGCAGGATT | ||||
ipaH | F: GTTCCTTGACCGCCTTTCCGATACCGTC | 52 | 619 | Toma et al. (2003)Toma C., Lu Y., Higa N., Nakasone N., Chinen I., Baschkier A., Rivas M. & Iwanaga M. 2003. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J. Clin. Microbiol. 41(6):2669-2671. <https://dx.doi.org/10.1128/JCM.41.6.2669-2671.2003> <PMid:12791900> https://doi.org/10.1128/JCM.41.6.2669-26... |
R: GCCGGTCAGCCACCCTCTGAGAGTAC | ||||
aatA | F: CTGGCGAAAGACTGTATCAT | 55 | 630 | Schmidt et al. (1995)Schmidt H., Knop C., Franke S., Aleksic S., Heesemann J. & Karch H. 1995. Development of PCR for screening of enteroaggregative Escherichia coli. J. Clin. Microbiol. 33(3):701-705. <https://dx.doi.org/10.1128/jcm.33.3.701-705.1995> <PMid:7751380> https://doi.org/10.1128/jcm.33.3.701-705... |
R: CAATGTATAGAAATCCGCTGTT | ||||
escN | F: CGACGACTATTGCAGAGT | 52 | 670 | Hernandes et al. (2009)Hernandes R.T., Elias W.P., Vieira M.A. & Gomes T.A. 2009. An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol. Letters 297(2):137-149. <https://dx.doi.org/10.1111/j.1574-6968.2009.01664.x> <PMid:19527295> https://doi.org/10.1111/j.1574-6968.2009... |
R: GCCTTATCTGCTTCAGGA |
-
The PCR products were submitted to 1.5% agarose gel electrophoresis (Electrophoresis Power Supply Model EPD 600; Amersham Pharmacia Biotech Inc.), and the bands were stained with SYBR Safe (Invitrogen). The images were obtained using the SmartView Pro Imager System 1200 (Major Science).
Table 2. In vitro sensitivity profile (disc diffusion method) in Escherichia coli strains isolated from individual samples of cows with clinical mastitis
Antimicrobial | Class | Sensitive % (N) | Partially sensitive % (N) | Resistant % (N) |
Ampicillin 10 mcg | Penicillin | 100 (12/12) | 0 (0/12) | 0 (0/12) |
Cefepime 30 mcg | 100 (12/12) | 0 (0/12) | 0 (0/12) | |
Cefotaxime 30 mcg | 83.34 (10/12) | 8.33 (1/12) | 8.33 (1/12) | |
Ceftriaxone 30 mcg | Cephalosporin | 91.67 (11/12) | 8.33 (1/12) | 0 (0/12) |
Ceftazidime 30 mcg | 100 (12/12) | 0 (0/12) | 0 (0/12) | |
Ceftiofur 30 mcg | 100 (12/12) | 0 (0/12) | 0 (0/12) | |
Cefoxitin 30 mcg | Cefamycin | 100 (12/12) | 0 (0/12) | 0 (0/12) |
Aztreonam 30 mcg | Monobactamic | 100 (12/12) | 0 (0/12) | 0 (0/12) |
Gentamicin 10 mcg | Aminoglycoside | 100 (12/12) | 0 (0/12) | 0 (0/12) |
Estreptomycin 10 mcg | 58.33 (7/12) | 25 (3/12) | 16.67 (2/12) | |
Tetracycline 30 mcg | Tetracycline | 75 (9/12) | 8.33 (1/12) | 16.67 (2/12) |